pAAV-hSyn-3xFLAG-WPRE
(Plasmid #127862)

• Purpose: pAAV plasmid expressing 3xFLAG under the hSyn promoter
• Depositing Lab: Florian Freudenberg
• Publication: Interaction of NOS1AP with the NOS-I PDZ domain: Implications for schizophrenia-related alterations in dendritic morphology. (unpublished)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	127862	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pAAV
  (Search Vector Database)
• Backbone size w/o insert (bp): 4578
• Total vector size (bp): 4644
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3xFLAG
• Species: Synthetic
• Insert Size (bp): 66
• Promoter: hSyn

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: cactgccagcttcagcac
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone was obtained from pAAV-hSyn-hChR2(H134R)-mCherry, a gift from Karl Deisseroth (Addgene plasmid # 26976).
• Terms and Licenses:
  • UBMTA
• Industry Terms:
  • Not Available to Industry