pAAV-hSyn-3xFLAG-WPRE
(Plasmid
#127862)
-
PurposepAAV plasmid expressing 3xFLAG under the hSyn promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 127862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4578
- Total vector size (bp) 4644
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xFLAG
-
SpeciesSynthetic
-
Insert Size (bp)66
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer cactgccagcttcagcac
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone was obtained from pAAV-hSyn-hChR2(H134R)-mCherry, a gift from Karl Deisseroth (Addgene plasmid # 26976).
-
Terms and Licenses
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-3xFLAG-WPRE was a gift from Florian Freudenberg (Addgene plasmid # 127862 ; http://n2t.net/addgene:127862 ; RRID:Addgene_127862)