pX330-RNMTg1-PITCh
(Plasmid
#127879)
-
PurposepX330 vector that espresses RNMT gRNA1, PITCh gRNA, and CAS9
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127879 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepX3301-6
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRNMT gRNA1, PITCh gRNA, and CAS9
-
gRNA/shRNA sequenceTGAAAAGATGTCTCTTGAAC
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-RNMTg1-PITCh was a gift from Peter Kaiser (Addgene plasmid # 127879) -
For your References section:
Microhomology based CRISPR tagging tools for protein tracking, purification, and depletion. Lin DW, Chung BP, Huang JW, Wang X, Huang L, Kaiser P. J Biol Chem. 2019 May 28. pii: RA119.008422. doi: 10.1074/jbc.RA119.008422. 10.1074/jbc.RA119.008422 PubMed 31138654