Skip to main content

pX330-RNMTg1-PITCh
(Plasmid #127879)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127879 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pX3301-6
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RNMT gRNA1, PITCh gRNA, and CAS9
  • gRNA/shRNA sequence
    TGAAAAGATGTCTCTTGAAC
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-RNMTg1-PITCh was a gift from Peter Kaiser (Addgene plasmid # 127879)
  • For your References section:

    Microhomology based CRISPR tagging tools for protein tracking, purification, and depletion. Lin DW, Chung BP, Huang JW, Wang X, Huang L, Kaiser P. J Biol Chem. 2019 May 28. pii: RA119.008422. doi: 10.1074/jbc.RA119.008422. 10.1074/jbc.RA119.008422 PubMed 31138654