Mouse 5' Npm1 AID GFP PuroR
(Plasmid
#127899)
-
PurposeHDR (donor) Plasmid for Inserting PuroR-2A-GFP-AID into the 5' end of the Mouse Npm1 Gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127899 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBSK
-
Vector typeDonor plasmid
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNpm1
-
Alt nameNucleophosmin
-
SpeciesM. musculus (mouse), A. thaliana (mustard weed)
-
Insert Size (bp)2094
-
GenBank IDNC_000081.6
-
Entrez GeneNpm1 (a.k.a. B23, NO38, Npm)
-
Tag
/ Fusion Protein
- GFP, AID, PuroR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagggttattgtctcatgagcgg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Mouse 5' Npm1 AID GFP PuroR was a gift from Mark Groudine (Addgene plasmid # 127899 ; http://n2t.net/addgene:127899 ; RRID:Addgene_127899)