Mouse 5' Srcap AID GFP Puro
(Plasmid
#127903)
-
PurposeHDR (donor) Plasmid for Inserting PuroR-2A-GFP-AID into the 5' end of the Mouse Srcap Gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127903 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBSk
-
Vector typeDonor plasmid
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSrcap
-
Alt nameSnf2-related CREBBP activator protein
-
SpeciesM. musculus (mouse), A. thaliana (mustard weed)
-
Insert Size (bp)2094
-
GenBank IDNC_000073.6
-
Entrez GeneSrcap (a.k.a. B930091H02Rik, D030022P06Rik, F630004O05Rik)
-
Tag
/ Fusion Protein
- GFP, AID, PuroR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagggttattgtctcatgagcgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Mouse 5' Srcap AID GFP Puro was a gift from Mark Groudine (Addgene plasmid # 127903 ; http://n2t.net/addgene:127903 ; RRID:Addgene_127903)