Human 3' HP1a AID GFP PuroR
(Plasmid
#127906)
-
PurposeHDR (donor) Plasmid for Inserting AID-GFP-2A-Puro into the 3' end of the Human HP1a Gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127906 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBSK
-
Vector typeDonor plasmid
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHP1
-
Alt nameCBX5
-
Alt nameHeterochromatin Protein 1A
-
SpeciesH. sapiens (human), A. thaliana (mustard weed)
-
Insert Size (bp)2097
-
MutationInserting GFP AID 2A Puro into mouse 3' Hp1a
-
GenBank IDNC_000012.12
-
Entrez GeneCBX5 (a.k.a. HEL25, HP1, HP1A, HP1alpha)
-
Tag
/ Fusion Protein
- GFP, AID, PuroR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgctgcaaggcgattaagttgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Human 3' HP1a AID GFP PuroR was a gift from Mark Groudine (Addgene plasmid # 127906 ; http://n2t.net/addgene:127906 ; RRID:Addgene_127906) -
For your References section:
HP1alpha is a chromatin crosslinker that controls nuclear and mitotic chromosome mechanics. Strom AR, Biggs RJ, Banigan EJ, Wang X, Chiu K, Herman C, Collado J, Yue F, Ritland Politz JC, Tait LJ, Scalzo D, Telling A, Groudine M, Brangwynne CP, Marko JF, Stephens AD. Elife. 2021 Jun 9;10. pii: 63972. doi: 10.7554/eLife.63972. 10.7554/eLife.63972 PubMed 34106828