pEf1a OsTIR ires NEO pA T2BH
(Plasmid
#127910)
-
PurposeTransposon vector containing an OsTIR IRES Neo cassette driven by the Ef1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127910 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBSK
-
Vector typeTransposon
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameOsTIR
-
Alt nameTir1
-
SpeciesA. thaliana (mustard weed)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tagatccgctccggtgcccgtca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEf1a OsTIR ires NEO pA T2BH was a gift from Mark Groudine (Addgene plasmid # 127910 ; http://n2t.net/addgene:127910 ; RRID:Addgene_127910) -
For your References section:
HP1alpha is a chromatin crosslinker that controls nuclear and mitotic chromosome mechanics. Strom AR, Biggs RJ, Banigan EJ, Wang X, Chiu K, Herman C, Collado J, Yue F, Ritland Politz JC, Tait LJ, Scalzo D, Telling A, Groudine M, Brangwynne CP, Marko JF, Stephens AD. Elife. 2021 Jun 9;10. pii: 63972. doi: 10.7554/eLife.63972. 10.7554/eLife.63972 PubMed 34106828