Skip to main content

NM1-5S-tRNA-SgH
(Plasmid #128178)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128178 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZPK
  • Backbone size w/o insert (bp) 6303
  • Total vector size (bp) 9317
  • Modifications to backbone
    R. toruloides hygromycin resistance gene added between LB and RB. R. toruloides 5S rRNA-tRNA(Arg) promoter and polyT terminator added between LB and hygromycin resistance gene.
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA cloning cassette
  • gRNA/shRNA sequence
    gRNA cloning cassette
  • Species
    Rhodosporidium toruloides
  • Promoter 5S rRNA-tRNA(Arg)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer CAAATTGACGCTTAGACAAC
  • 3′ sequencing primer TATATCCTGTCAAACACTGATAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    5S-tRNA cassette synthesized by Genscript. hygR gene received from Professor Zongbao K. Zhao.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NM1-5S-tRNA-SgH was a gift from Huimin Zhao (Addgene plasmid # 128178 ; http://n2t.net/addgene:128178 ; RRID:Addgene_128178)
  • For your References section:

    Development of a CRISPR/Cas9 system for high efficiency multiplexed gene deletion in Rhodosporidium toruloides. Schultz JC, Cao M, Zhao H. Biotechnol Bioeng. 2019 Apr 30. doi: 10.1002/bit.27001. 10.1002/bit.27001 PubMed 31038202