-
PurposeExpresses gRNA using fusion of R. toruloides 5S rRNA and tRNA-Arg as promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128178 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepZPK
- Backbone size w/o insert (bp) 6303
- Total vector size (bp) 9317
-
Modifications to backboneR. toruloides hygromycin resistance gene added between LB and RB. R. toruloides 5S rRNA-tRNA(Arg) promoter and polyT terminator added between LB and hygromycin resistance gene.
-
Vector typeYeast Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA cloning cassette
-
gRNA/shRNA sequencegRNA cloning cassette
-
SpeciesRhodosporidium toruloides
- Promoter 5S rRNA-tRNA(Arg)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer CAAATTGACGCTTAGACAAC
- 3′ sequencing primer TATATCCTGTCAAACACTGATAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made by5S-tRNA cassette synthesized by Genscript. hygR gene received from Professor Zongbao K. Zhao.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NM1-5S-tRNA-SgH was a gift from Huimin Zhao (Addgene plasmid # 128178 ; http://n2t.net/addgene:128178 ; RRID:Addgene_128178) -
For your References section:
Development of a CRISPR/Cas9 system for high efficiency multiplexed gene deletion in Rhodosporidium toruloides. Schultz JC, Cao M, Zhao H. Biotechnol Bioeng. 2019 Apr 30. doi: 10.1002/bit.27001. 10.1002/bit.27001 PubMed 31038202