pBM019
(Plasmid
#128179)
-
PurposeConstruct for generating stable Cas9-expressing Toxoplasma gondii
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128179 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 9826
-
Vector typeCRISPR ; Toxoplasma gondii expression
-
Selectable markersChloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesgRNA#1
-
SpeciesSynthetic; Streptococcus pyogenes, Toxoplasma gondii
-
Insert Size (bp)97
- Promoter U6 (Toxoplasma gondii)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer taatacgactcactatagg
- 3′ sequencing primer ggaaagggcgaaattcaagagag (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSpCas9
-
SpeciesSynthetic; originally from Streptococcus pyogenes, human codon-optimized
-
Insert Size (bp)4101
- Promoter TUB1 (Toxoplasma gondii)
-
Tags
/ Fusion Proteins
- 3X FLAG (N terminal on insert)
- Nuclear Localization Signal (N terminal on insert)
- Nuclear Localization Signal (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer aacccgcgcagaagacatcc
- 3′ sequencing primer AACTTCCTGTACCTGGCCAGC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameChloramphenicol acetyltransferase
-
Alt nameCAT
-
SpeciesShigella flexneri
-
Insert Size (bp)657
- Promoter linked to SpCas9 via P2A peptide
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer AACTTCCTGTACCTGGCCAGC
- 3′ sequencing primer ctctccgacccgaggcactc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBM019 was a gift from Sebastian Lourido (Addgene plasmid # 128179 ; http://n2t.net/addgene:128179 ; RRID:Addgene_128179) -
For your References section:
Optimizing Systems for Cas9 Expression in Toxoplasma gondii. Markus BM, Bell GW, Lorenzi HA, Lourido S. mSphere. 2019 Jun 26;4(3). pii: 4/3/e00386-19. doi: 10.1128/mSphere.00386-19. 10.1128/mSphere.00386-19 PubMed 31243081