pBM019
(Plasmid #128179)

• Purpose: Construct for generating stable Cas9-expressing Toxoplasma gondii
• Depositing Lab: Sebastian Lourido
• Depositing Organization: Whitehead Institute for Biomedical Research
  Located in the United States of America
• Publication: Markus et al mSphere. 2019 Jun 26;4(3). pii: 4/3/e00386-19. doi: 10.1128/mSphere.00386-19.

Backbone

• Vector backbone: pX330
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 9826
• Vector type: CRISPR ; Toxoplasma gondii expression
• Selectable markers: Chloramphenicol

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: sgRNA#1
• Species: Synthetic; Streptococcus pyogenes, Toxoplasma gondii
• Insert Size (bp): 97
• Promoter: U6 (Toxoplasma gondii)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: taatacgactcactatagg
• 3′ sequencing primer: ggaaagggcgaaattcaagagag

Gene/Insert 2

• Gene/Insert name: SpCas9
• Species: Synthetic; originally from Streptococcus pyogenes, human codon-optimized
• Insert Size (bp): 4101
• Promoter: TUB1 (Toxoplasma gondii)
• Tags / Fusion Proteins:
  • 3X FLAG (N terminal on insert)
  • Nuclear Localization Signal (N terminal on insert)
  • Nuclear Localization Signal (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aacccgcgcagaagacatcc
• 3′ sequencing primer: AACTTCCTGTACCTGGCCAGC

Gene/Insert 3

• Gene/Insert name: Chloramphenicol acetyltransferase
• Alt name: CAT
• Species: Shigella flexneri
• Insert Size (bp): 657
• Promoter: linked to SpCas9 via P2A peptide

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AACTTCCTGTACCTGGCCAGC
• 3′ sequencing primer: ctctccgacccgaggcactc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 128179-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 128179-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.