pTUB1-Sth.dCas9-P2A-CAT-T2A-TagBFP
(Plasmid #171090)

• Purpose: CRISPR interference. Construct for expressing catalytically inactive Cas9 (dCas9) from Streptococcus thermophilus (CRISPR1 locus) in Toxoplasma gondii. Suitable for generating stable cell lines.
• Depositing Lab: Sebastian Lourido
• Publication: Markus et al mSphere. 2021 Oct 13:e0047421. doi: 10.1128/mSphere.00474-21.

Backbone

• Vector backbone: pUC19
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 8529
• Vector type: CRISPR ; Toxoplasma gondii expression
• Selectable markers: Chloramphenicol

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Sth1 dCas9
• Alt name: Streptococcus thermophilus CRISPR1 dCas9
• Species: Streptococcus thermophilus
• Insert Size (bp): 3363
• Mutation: D9A, H599A
• Promoter: TUB1 (Toxoplasma gondii)
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • SV40 NLS (N terminal on insert)
  • nucleoplasmin NLS (C terminal on insert)
  • P2A peptide (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tggtgatcctggttggaccg
• 3′ sequencing primer: cgtaacacgccacatcttgc

Gene/Insert 2

• Gene/Insert name: Chloramphenicol acetyltransferase
• Alt name: CAT
• Species: Shigella flexneri
• Insert Size (bp): 660
• Promoter: transcriptionally linked to Sth1 dCas9 via P2A peptide
• Tag / Fusion Protein:
  • T2A peptide (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgtaacacgccacatcttgc
• 3′ sequencing primer: gtgttcacccttgttacaccg

Gene/Insert 3

• Gene/Insert name: TagBFP
• Alt name: monomeric blue fluorescent protein
• Insert Size (bp): 702
• Promoter: transcriptionally linked to CAT via T2A peptide

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtgttcacccttgttacaccg
• 3′ sequencing primer: caatcgttcgcggtgaagag

Resource Information

• Supplemental Documents:
  • pTUB1-Sth.dCas9-P2A-CAT-T2A-TagBFP.gb
• A portion of this plasmid was derived from a plasmid made by: The Sth1 dCas9 insert was cloned from a previously published plasmid, which was kindly provided to us by Jeremy Rock and Sarah Fortune. Rock JM, Hopkins FF, Chavez A, et al. Programmable transcriptional repression in mycobacteria using an orthogonal CRISPR interference platform. Nat Microbiol. 2017;2:16274. Published 2017 Feb 6. doi:10.1038/nmicrobiol.2016.274

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry