pU6-Universal.Sth.dCas9
(Plasmid #171088)

• Purpose: CRISPR interference. Recipient construct for cloning 20-nt spacers into the sgRNA scaffold compatible with Streptococcus thermophilus dCas9 (CRISPR1 system) via BsaI restriction sites.
• Depositing Lab: Sebastian Lourido
• Publication: Markus et al mSphere. 2021 Oct 13:e0047421. doi: 10.1128/mSphere.00474-21.

Backbone

• Vector backbone: pU6-Universal
• Backbone size w/o insert (bp): 2643
• Total vector size (bp): 6285
• Vector type: Toxoplasma gondii expression
• Selectable markers: Pyrimethamine

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): dam-/dcm- (NEB catalog # C2925I)
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Toxoplasma U6 upstream region – spacer cloning site - sgRNA scaffold (compatible with S. thermophilus Cas9 CRISPR1)
• Species: Synthetic; Streptococcus thermophilus, Toxoplasma gondii
• Insert Size (bp): 611
• Promoter: U6 (Toxoplasma gondii)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: gcgggacagagttgtctcgac
• 3′ sequencing primer: gcgggacagagttgtctcgac

Gene/Insert 2

• Gene/Insert name: DHFR-TSc3
• Species: Toxoplasma gondii
• Insert Size (bp): 3057
• Mutation: Note: A S245F mutation is present but did not appear to affect drug selection with pyrimethamine
• Promoter: DHFR-TS (Toxoplasma gondii)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NsiI (not destroyed)
• 3′ cloning site: SbfI (not destroyed)
• 5′ sequencing primer: gcgggacagagttgtctcgac
• 3′ sequencing primer: tctagaactagtggatc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This construct was adapted from a previously published plasmid by Saima Sidik et al. (Addgene plasmid # 52694). The sgRNA scaffold was cloned from another published plasmid, which was kindly provided to us by Jeremy Rock and Sarah Fortune (Rock JM, Hopkins FF, Chavez A, et al. Programmable transcriptional repression in mycobacteria using an orthogonal CRISPR interference platform. Nat Microbiol. 2017;2:16274. Published 2017 Feb 6. doi:10.1038/nmicrobiol.2016.274).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry