pU6-Universal.Sth.dCas9
(Plasmid
#171088)
-
PurposeCRISPR interference. Recipient construct for cloning 20-nt spacers into the sgRNA scaffold compatible with Streptococcus thermophilus dCas9 (CRISPR1 system) via BsaI restriction sites.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepU6-Universal
- Backbone size w/o insert (bp) 2643
- Total vector size (bp) 6285
-
Vector typeToxoplasma gondii expression
-
Selectable markersPyrimethamine
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)dam-/dcm- (NEB catalog # C2925I)
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameToxoplasma U6 upstream region – spacer cloning site - sgRNA scaffold (compatible with S. thermophilus Cas9 CRISPR1)
-
SpeciesSynthetic; Streptococcus thermophilus, Toxoplasma gondii
-
Insert Size (bp)611
- Promoter U6 (Toxoplasma gondii)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer gcgggacagagttgtctcgac
- 3′ sequencing primer gcgggacagagttgtctcgac (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameDHFR-TSc3
-
SpeciesToxoplasma gondii
-
Insert Size (bp)3057
-
MutationNote: A S245F mutation is present but did not appear to affect drug selection with pyrimethamine
- Promoter DHFR-TS (Toxoplasma gondii)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site SbfI (not destroyed)
- 5′ sequencing primer gcgggacagagttgtctcgac
- 3′ sequencing primer tctagaactagtggatc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis construct was adapted from a previously published plasmid by Saima Sidik et al. (Addgene plasmid # 52694). The sgRNA scaffold was cloned from another published plasmid, which was kindly provided to us by Jeremy Rock and Sarah Fortune (Rock JM, Hopkins FF, Chavez A, et al. Programmable transcriptional repression in mycobacteria using an orthogonal CRISPR interference platform. Nat Microbiol. 2017;2:16274. Published 2017 Feb 6. doi:10.1038/nmicrobiol.2016.274).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-Universal.Sth.dCas9 was a gift from Sebastian Lourido (Addgene plasmid # 171088 ; http://n2t.net/addgene:171088 ; RRID:Addgene_171088) -
For your References section:
CRISPR-Mediated Transcriptional Repression in Toxoplasma gondii. Markus BM, Boydston EA, Lourido S. mSphere. 2021 Oct 13:e0047421. doi: 10.1128/mSphere.00474-21. 10.1128/mSphere.00474-21 PubMed 34643425