Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBM019
(Plasmid #128179)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128179 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX330
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 9826
  • Vector type
    CRISPR ; Toxoplasma gondii expression
  • Selectable markers
    Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sgRNA#1
  • Species
    Synthetic; Streptococcus pyogenes, Toxoplasma gondii
  • Insert Size (bp)
    97
  • Promoter U6 (Toxoplasma gondii)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer taatacgactcactatagg
  • 3′ sequencing primer ggaaagggcgaaattcaagagag
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    SpCas9
  • Species
    Synthetic; originally from Streptococcus pyogenes, human codon-optimized
  • Insert Size (bp)
    4101
  • Promoter TUB1 (Toxoplasma gondii)
  • Tags / Fusion Proteins
    • 3X FLAG (N terminal on insert)
    • Nuclear Localization Signal (N terminal on insert)
    • Nuclear Localization Signal (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aacccgcgcagaagacatcc
  • 3′ sequencing primer AACTTCCTGTACCTGGCCAGC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Chloramphenicol acetyltransferase
  • Alt name
    CAT
  • Species
    Shigella flexneri
  • Insert Size (bp)
    657
  • Promoter linked to SpCas9 via P2A peptide

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AACTTCCTGTACCTGGCCAGC
  • 3′ sequencing primer ctctccgacccgaggcactc
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBM019 was a gift from Sebastian Lourido (Addgene plasmid # 128179 ; http://n2t.net/addgene:128179 ; RRID:Addgene_128179)
  • For your References section:

    Optimizing Systems for Cas9 Expression in Toxoplasma gondii. Markus BM, Bell GW, Lorenzi HA, Lourido S. mSphere. 2019 Jun 26;4(3). pii: 4/3/e00386-19. doi: 10.1128/mSphere.00386-19. 10.1128/mSphere.00386-19 PubMed 31243081