pDN-D2irTN2AG5kwh
(Plasmid #128253)

• Purpose: Mammalian linearizer gene circuit in a Flp-In expression system based on negative feedback. The hTetR and EGFP is separated by a P2A motif.
• Depositing Lab: Gabor Balazsi
• Depositing Organization: Stony Brook University
  Located in the United States of America
• Publication: Farquhar et al Nat Commun. 2019 Jun 24;10(1):2766. doi: 10.1038/s41467-019-10330-w.
• Citations: 1 Article

Backbone

• Vector backbone: pDN-D2irTNG5kwh
• Backbone manufacturer: Custom
• Backbone size w/o insert (bp): 7505
• Total vector size (bp): 7547
• Vector type: Mammalian Expression, Synthetic Biology ; Flp-In expression vector
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Beta Globin Intron::hTetR::P2A::EGFP
• Alt name: Beta Globin Intron
• Alt name: Humanized Tetracycline Repressor
• Alt name: EGFP
• Species: Synthetic
• Insert Size (bp): 2817
• Promoter: CMV D2ir promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ACGGGCCAGATATACGCGTT
• 3′ sequencing primer: CCATAGAGCCCACCGCATCCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The human codon-optimized TetR regulator was previously developed in pDN-D2irTNG4kwh (Addgene plasmid # 44722; Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid encodes a mammalian synthetic gene circuit with the humanized Tetracycline Repressor (hTetR) regulator separated from EGFP by a P2A motif, which is controlled by a CMV-derived promoter containing 2 tetO2 sites. With hTetR binding to the promoter, negative feedback lowers gene expression noise while linearizing the mean dose response. The circuit is also called mNF-GFP and is within a Flp-In expression vector.

DNA (Catalog # 128253-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 128253-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.