Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMTG03-AmpFRT
(Plasmid #128272)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128272 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCB-D2ir-GKwh-D2irTN5kwh
  • Total vector size (bp) 6570
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    TetR-LOV-TIP
  • Alt name
    Tetracycline repressor, Light-oxygen-voltage-sensing domain, tet-inhibiting peptide
  • Species
    Synthetic
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer tttttggctactacacttg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    EGFP
  • Species
    Synthetic
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CCTACGGCAAGCTGACCCTGAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional relevant information can be found from this publciation: Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMTG03-AmpFRT was a gift from Gabor Balazsi (Addgene plasmid # 128272 ; http://n2t.net/addgene:128272 ; RRID:Addgene_128272)
  • For your References section:

    Noise-reducing optogenetic negative-feedback gene circuits in human cells. Guinn MT, Balazsi G. Nucleic Acids Res. 2019 Jul 3. pii: 5527975. doi: 10.1093/nar/gkz556. 10.1093/nar/gkz556 PubMed 31269201