Skip to main content

pDN-D2irTNG5kwh
(Plasmid #128279)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128279 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA5/FRT
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5070
  • Total vector size (bp) 7505
  • Vector type
    Mammalian Expression, Synthetic Biology ; Flp-In expression vector
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hTetR::NLS::EGFP
  • Alt name
    hTetR
  • Alt name
    Nuclear localization sequence
  • Alt name
    EGFP
  • Species
    Synthetic
  • Insert Size (bp)
    3414
  • Promoter CMV-D2ir promoter
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site SphI (not destroyed)
  • 5′ sequencing primer ACGGGCCAGATATACGCGTT
  • 3′ sequencing primer CCATAGAGCCCACCGCATCCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The human codon-optimized TetR regulator was previously developed in pDN-D2irTNG4kwh (Addgene plasmid # 44722; Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid encodes a mammalian synthetic gene circuit with a fusion humanized TetR::NLS::EGFP protein, which can bind to the CMV-derived promoter with two tetO2 sites (CMV-D2ir) to repress its own expression in a negative feedback loop. The plasmid is used as an intermediate backbone towards constructing pDN-D2irTN2AG5kwh. It is able to integrate into genomic FRT sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDN-D2irTNG5kwh was a gift from Gabor Balazsi (Addgene plasmid # 128279 ; http://n2t.net/addgene:128279 ; RRID:Addgene_128279)
  • For your References section:

    Role of network-mediated stochasticity in mammalian drug resistance. Farquhar KS, Charlebois DA, Szenk M, Cohen J, Nevozhay D, Balazsi G. Nat Commun. 2019 Jun 24;10(1):2766. doi: 10.1038/s41467-019-10330-w. 10.1038/s41467-019-10330-w PubMed 31235692