Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-Ef1a-fDIO-JRGECO1a
(Plasmid #128317)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128317 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-Ef1a-fDIO
  • Backbone manufacturer
    Addgene # 55641
  • Backbone size w/o insert (bp) 6323
  • Total vector size (bp) 7025
  • Modifications to backbone
    EYFP cDNA removed by AscI-NheI double digest
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NES-JRGECO1a
  • Species
    Synthetic
  • Insert Size (bp)
    1431
  • Promoter Ef1a
  • Tag / Fusion Protein
    • His Tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    NES-JRGECO1a cDNA was obtained as a NotI-BglII fragment from Addgene #61563. Vector backbone was derived from Addgene # 55641.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-fDIO-JRGECO1a was a gift from Patricia Jensen (Addgene plasmid # 128317 ; http://n2t.net/addgene:128317 ; RRID:Addgene_128317)