Skip to main content

pCIneoLuc-TEAD4
(Plasmid #128335)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128335 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCIneo
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TEAD4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1300
  • GenBank ID
    7004
  • Entrez Gene
    TEAD4 (a.k.a. EFTR-2, RTEF1, TCF13L1, TEF-3, TEF3, TEFR-1, hRTEF-1B)
  • Promoter CMV
  • Tag / Fusion Protein
    • Luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer gataggcacctattggtcttactgacat
  • 3′ sequencing primer Gaacctgaaacataaaatgaat
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert for TEAD4 contains L552F and S862G compared to the reference NP_003204.2 that do not impact function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCIneoLuc-TEAD4 was a gift from Yutaka Hata (Addgene plasmid # 128335 ; http://n2t.net/addgene:128335 ; RRID:Addgene_128335)
  • For your References section:

    Novel YAP1 Activator, Identified by Transcription-Based Functional Screen, Limits Multiple Myeloma Growth. Maruyama J, Inami K, Michishita F, Jiang X, Iwasa H, Nakagawa K, Ishigami-Yuasa M, Kagechika H, Miyamura N, Hirayama J, Nishina H, Nogawa D, Yamamoto K, Hata Y. Mol Cancer Res. 2018 Feb;16(2):197-211. doi: 10.1158/1541-7786.MCR-17-0382. Epub 2017 Oct 23. 10.1158/1541-7786.MCR-17-0382 PubMed 29061667