Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pJL1-PD-4xDQNAT
(Plasmid #128391)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128391 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJL1
  • Backbone size w/o insert (bp) 1765
  • Total vector size (bp) 2848
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Protein D
  • Species
    H. influenzae
  • Insert Size (bp)
    1086
  • Promoter T7
  • Tags / Fusion Proteins
    • 4xDQNAT glycosylation tag (C terminal on insert)
    • 6xHis tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGTTATTGCTCAGCGGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJL1-PD-4xDQNAT was a gift from Michael Jewett (Addgene plasmid # 128391 ; http://n2t.net/addgene:128391 ; RRID:Addgene_128391)
  • For your References section:

    On-demand biomanufacturing of protective conjugate vaccines. Stark JC, Jaroentomeechai T, Moeller TD, Hershewe JM, Warfel KF, Moricz BS, Martini AM, Dubner RS, Hsu KJ, Stevenson TC, Jones BD, DeLisa MP, Jewett MC. Sci Adv. 2021 Feb 3;7(6). pii: 7/6/eabe9444. doi: 10.1126/sciadv.abe9444. Print 2021 Feb. 10.1126/sciadv.abe9444 PubMed 33536221