pJL1-CRM197-4xDQNAT
(Plasmid
#128395)
-
PurposeIn vitro expression of CRM197 with C terminal 4xDQNAT glycosylation sites
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128395 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJL1
- Backbone size w/o insert (bp) 1765
- Total vector size (bp) 3481
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDiphtheria toxin
-
SpeciesC. diphtheriae
-
Insert Size (bp)1716
-
MutationInactivating G52E mutation
- Promoter T7
-
Tags
/ Fusion Proteins
- 4xDQNAT glycosylation tag (C terminal on insert)
- 6xHis tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGTTATTGCTCAGCGGTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL1-CRM197-4xDQNAT was a gift from Michael Jewett (Addgene plasmid # 128395 ; http://n2t.net/addgene:128395 ; RRID:Addgene_128395) -
For your References section:
On-demand biomanufacturing of protective conjugate vaccines. Stark JC, Jaroentomeechai T, Moeller TD, Hershewe JM, Warfel KF, Moricz BS, Martini AM, Dubner RS, Hsu KJ, Stevenson TC, Jones BD, DeLisa MP, Jewett MC. Sci Adv. 2021 Feb 3;7(6). pii: 7/6/eabe9444. doi: 10.1126/sciadv.abe9444. Print 2021 Feb. 10.1126/sciadv.abe9444 PubMed 33536221