Skip to main content

pTrc99S-ssDsbA-EPA-DNNNS-DQNRT
(Plasmid #128404)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128404 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTrc99S
  • Backbone size w/o insert (bp) 4535
  • Total vector size (bp) 6442
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin and Streptomycin, 50 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Exotoxin A
  • Species
    P. aeruginosa
  • Insert Size (bp)
    1906
  • Mutation
    242DNNNS246 and 384DQNRT388 engineered glycosylation sites
  • Entrez Gene
    toxA (a.k.a. PA1148)
  • Promoter trc
  • Tags / Fusion Proteins
    • 6xHis tag (C terminal on insert)
    • DsbA signal sequence for periplasmic translocation (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACAATTAATCATCCGGCTCG
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Exotoxin A with internal DNNNS and DQNRT glycosylation sites was originally described by Cuccui, et al. doi.org/10.1098/rsob.130002

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTrc99S-ssDsbA-EPA-DNNNS-DQNRT was a gift from Michael Jewett (Addgene plasmid # 128404 ; http://n2t.net/addgene:128404 ; RRID:Addgene_128404)
  • For your References section:

    On-demand biomanufacturing of protective conjugate vaccines. Stark JC, Jaroentomeechai T, Moeller TD, Hershewe JM, Warfel KF, Moricz BS, Martini AM, Dubner RS, Hsu KJ, Stevenson TC, Jones BD, DeLisa MP, Jewett MC. Sci Adv. 2021 Feb 3;7(6). pii: 7/6/eabe9444. doi: 10.1126/sciadv.abe9444. Print 2021 Feb. 10.1126/sciadv.abe9444 PubMed 33536221