pNM261
(Plasmid
#128411)
-
PurposeVanillic acid inducible production of lysostaphin. LsyT with no signaling peptide for secretion.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128411 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLG320
- Backbone size w/o insert (bp) 7657
- Total vector size (bp) 8395
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLysostaphin
-
SpeciesStaphylococcus simulans
-
Entrez Geneepr (a.k.a. pACK1_p44)
- Promoter Pspank(V)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caaatccgccgctctagctaag
- 3′ sequencing primer gacccggtttaatacgagg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNM261 was a gift from Christopher Voigt (Addgene plasmid # 128411 ; http://n2t.net/addgene:128411 ; RRID:Addgene_128411) -
For your References section:
Resilient living materials built by printing bacterial spores. Gonzalez LM, Mukhitov N, Voigt CA. Nat Chem Biol. 2019 Dec 2. pii: 10.1038/s41589-019-0412-5. doi: 10.1038/s41589-019-0412-5. 10.1038/s41589-019-0412-5 PubMed 31792444