Skip to main content

pNM262
(Plasmid #128412)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128412 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLG320
  • Backbone size w/o insert (bp) 7499
  • Total vector size (bp) 8497
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lysostaphin
  • Species
    Staphylococcus simulans
  • Entrez Gene
    epr (a.k.a. pACK1_p44)
  • Promoter Pspank(V)
  • Tag / Fusion Protein
    • amyE SP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caaatccgccgctctagctaag
  • 3′ sequencing primer gacccggtttaatacgagg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNM262 was a gift from Christopher Voigt (Addgene plasmid # 128412 ; http://n2t.net/addgene:128412 ; RRID:Addgene_128412)
  • For your References section:

    Resilient living materials built by printing bacterial spores. Gonzalez LM, Mukhitov N, Voigt CA. Nat Chem Biol. 2019 Dec 2. pii: 10.1038/s41589-019-0412-5. doi: 10.1038/s41589-019-0412-5. 10.1038/s41589-019-0412-5 PubMed 31792444