pMJA053
(Plasmid
#128515)
-
PurposeExpresses SFA8 in Pichia
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128515 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPIC9
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 8014
-
Vector typeYeast Expression
-
Selectable markersHIS4
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSFA8 a 2S albumin from sunflower
-
SpeciesHelianthus annus
-
Insert Size (bp)318
-
Entrez GeneLOC110892047 (a.k.a. HannXRQ_Chr11g0337861, 2SS8, SFA8)
- Promoter AOX1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGACTGGTTCCAATTGACAAGCTTT
- 3′ sequencing primer TGCATCTCTCAGGCAAATGGCA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGiven by Prof P Shewry, Rothamstead.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
secreted SFA8 mature 2S albumin storage protein from sunflower seed. Also reference PMID: 12911791.
Addgene NGS found a frameshift and early termination of the a-factor secretion signal-CDS(SFA8)_1 translation, compared to the reference sequence provided by the Alcocer laboratory. The Alcocer laboratory has confirmed that this plasmid has been used in the production of intact proteins in large scale fermenters
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJA053 was a gift from Marcos Alcocer (Addgene plasmid # 128515 ; http://n2t.net/addgene:128515 ; RRID:Addgene_128515) -
For your References section:
The disulphide mapping, folding and characterisation of recombinant Ber e 1, an allergenic protein, and SFA8, two sulphur-rich 2S plant albumins. Alcocer MJ, Murtagh GJ, Bailey K, Dumoulin M, Meseguer AS, Parker MJ, Archer DB. J Mol Biol. 2002 Nov 15;324(1):165-75. S0022283602010616 [pii] PubMed 12421566