pMJA056
(Plasmid
#128516)
-
PurposeExpresses Xylanase B+GUS
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128516 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBluescript
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5458
-
Vector typeBacterial Expression
-
Selectable markersUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXylanase B + uidA
-
Alt nameAJ489605.1
-
SpeciesTalaromyces funiculosus
-
Insert Size (bp)924
- Promoter Histone 4B
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer ATTACGCCAAGCTCGAAATTAACCCT
- 3′ sequencing primer GTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
expression of Xylanase B fused to GUS reporter gene
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJA056 was a gift from Marcos Alcocer (Addgene plasmid # 128516 ; http://n2t.net/addgene:128516 ; RRID:Addgene_128516) -
For your References section:
Comparison of modular and non-modular xylanases as carrier proteins for the efficient secretion of heterologous proteins from Penicillium funiculosum. Alcocer MJ, Furniss CS, Kroon PA, Campbell M, Archer DB. Appl Microbiol Biotechnol. 2003 Feb;60(6):726-32. doi: 10.1007/s00253-002-1184-4. Epub 2002 Dec 21. 10.1007/s00253-002-1184-4 PubMed 12664153