pMJA295
(Plasmid
#128543)
-
PurposeExpresses nut lipid binding TCR
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1(+)/Zeo(+)
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 4798
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLipid binding Human TCR
-
Alt nameMK764036*
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2759
- Promoter bidirectional CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTGTGAGCCAGGGCATTGG
- 3′ sequencing primer GACAATGCGATGCAATTTCCTCAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lipid binding gamma delta TCR. 5' cloning site Esp31 (not destroyed). 3' cloning site Esp31 (not destroyed).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJA295 was a gift from Marcos Alcocer (Addgene plasmid # 128543 ; http://n2t.net/addgene:128543 ; RRID:Addgene_128543)