pGJM010
(Plasmid
#128546)
-
PurposeExpresses Chimera SFA8+BN
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPIC9
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 8016
-
Vector typeYeast Expression
-
Selectable markersHIS4
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameChimera SFA8+Ber e 2
-
SpeciesBertholletia excelsa+Helianthus annus
-
Insert Size (bp)333
- Promoter AOX1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGACTGGTTCCAATTGACAAGCTTT
- 3′ sequencing primer TGCATCTCTCAGGCAAATGGCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
secreted SFA8+Ber e 1 helix 3
Addgene NGS found a frameshift and early termination of the a-factor secretion signal-CDS(SFA8)_1 translation, compared to the reference sequence provided by the Alcocer laboratory. The Alcocer laboratory has confirmed that the protein is not mutated and this is a structural chimera protein
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGJM010 was a gift from Marcos Alcocer (Addgene plasmid # 128546 ; http://n2t.net/addgene:128546 ; RRID:Addgene_128546) -
For your References section:
The major human structural IgE epitope of the Brazil nut allergen Ber e 1: a chimaeric and protein microarray approach. Alcocer MJ, Murtagh GJ, Wilson PB, Progias P, Lin J, Archer DB. J Mol Biol. 2004 Oct 22;343(3):759-69. doi: 10.1016/j.jmb.2004.08.065. 10.1016/j.jmb.2004.08.065 PubMed 15465060