Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #128547)


Item Catalog # Description Quantity Price (USD)
Plasmid 128547 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 8016
  • Vector type
    Yeast Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    Chimera SFA8+Ber e 3
  • Species
    Bertholletia excelsa+Helianthus annus
  • Insert Size (bp)
  • Promoter AOX1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGACTGGTTCCAATTGACAAGCTTT
  • 3′ sequencing primer TGCATCTCTCAGGCAAATGGCA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

secreted SFA8(N)+Ber e 1 C terminal

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGJM012 was a gift from Marcos Alcocer (Addgene plasmid # 128547 ; ; RRID:Addgene_128547)
  • For your References section:

    The major human structural IgE epitope of the Brazil nut allergen Ber e 1: a chimaeric and protein microarray approach. Alcocer MJ, Murtagh GJ, Wilson PB, Progias P, Lin J, Archer DB. J Mol Biol. 2004 Oct 22;343(3):759-69. doi: 10.1016/j.jmb.2004.08.065. 10.1016/j.jmb.2004.08.065 PubMed 15465060