Skip to main content

pGJM015
(Plasmid #128549)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128549 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPIC9
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 8016
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Chimera SFA8+Ber e 5
  • Species
    Bertholletia excelsa+Helianthus annus
  • Insert Size (bp)
    333
  • Promoter AOX1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGACTGGTTCCAATTGACAAGCTTT
  • 3′ sequencing primer TGCATCTCTCAGGCAAATGGCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

secreted SFA8+Ber e 1 turn 4

Addgene NGS found a deletion that eliminates the stop codon after CDS(SFA8)_1, compared to the reference sequence provided by the Alcocer laboratory. The Alcocer laboratory is aware of this discrepancy

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGJM015 was a gift from Marcos Alcocer (Addgene plasmid # 128549 ; http://n2t.net/addgene:128549 ; RRID:Addgene_128549)
  • For your References section:

    The major human structural IgE epitope of the Brazil nut allergen Ber e 1: a chimaeric and protein microarray approach. Alcocer MJ, Murtagh GJ, Wilson PB, Progias P, Lin J, Archer DB. J Mol Biol. 2004 Oct 22;343(3):759-69. doi: 10.1016/j.jmb.2004.08.065. 10.1016/j.jmb.2004.08.065 PubMed 15465060