SStart-36xMashTag-BFP-3xStop-24xPP7 (Sunstart-MashTag reporter)
(Plasmid
#128608)
-
PurposeExpresses 36xMashTag with SunTag frame as mainframe, followed by BFP linker and 24 repeats of PP7 hairpins in 3’ UTR.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128608 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA4/TO
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name36xMashTag
- Promoter Pcmv
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid has 24 repeats of PP7 hairpins in 3'UTR.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SStart-36xMashTag-BFP-3xStop-24xPP7 (Sunstart-MashTag reporter) was a gift from Marvin Tanenbaum (Addgene plasmid # 128608 ; http://n2t.net/addgene:128608 ; RRID:Addgene_128608) -
For your References section:
Multi-Color Single-Molecule Imaging Uncovers Extensive Heterogeneity in mRNA Decoding. Boersma S, Khuperkar D, Verhagen BMP, Sonneveld S, Grimm JB, Lavis LD, Tanenbaum ME. Cell. 2019 Jun 5. pii: S0092-8674(19)30499-4. doi: 10.1016/j.cell.2019.05.001. 10.1016/j.cell.2019.05.001 PubMed 31178119