Skip to main content

pBT346.6-H3.3-K4M-bGHpolyA
(Plasmid #128743)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128743 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 128743-D50 50 μg of DNA in Tris buffer $495
DNA 128743-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pBT346.6
  • Backbone manufacturer
    Applied StemCell
  • Backbone size w/o insert (bp) 818
  • Total vector size (bp) 7065
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    H3.3K4M
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    553
  • Mutation
    K4M
  • GenBank ID
    NM_002107.6
  • Entrez Gene
    H3-3A (a.k.a. BRYLIB1, H3-3B, H3.3A, H3F3, H3F3A)
  • Promoter CAG
  • Tags / Fusion Proteins
    • FLAG (C terminal on insert)
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer CTTATATAACTTCGTATAATG
  • 3′ sequencing primer GTCAGCTTTTTGTACAAACT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBT346.6-H3.3-K4M-bGHpolyA was a gift from Kai Ge (Addgene plasmid # 128743 ; http://n2t.net/addgene:128743 ; RRID:Addgene_128743)
  • For your References section:

    H3.3K4M destabilizes enhancer H3K4 methyltransferases MLL3/MLL4 and impairs adipose tissue development. Jang Y, Broun A, Wang C, Park YK, Zhuang L, Lee JE, Froimchuk E, Liu C, Ge K. Nucleic Acids Res. 2019 Jan 25;47(2):607-620. doi: 10.1093/nar/gky982. 10.1093/nar/gky982 PubMed 30335158