pBT346.6-H3.3-K4M-bGHpolyA
(Plasmid
#128743)
-
PurposeInducible expression of histone H3.3K4M-FLAG/HA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128743 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBT346.6
-
Backbone manufacturerApplied StemCell
- Backbone size w/o insert (bp) 818
- Total vector size (bp) 7065
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameH3.3K4M
-
SpeciesH. sapiens (human)
-
Insert Size (bp)553
-
MutationK4M
-
GenBank IDNM_002107.6
-
Entrez GeneH3-3A (a.k.a. BRYLIB1, H3-3B, H3.3A, H3F3, H3F3A)
- Promoter CAG
-
Tags
/ Fusion Proteins
- FLAG (C terminal on insert)
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer CTTATATAACTTCGTATAATG
- 3′ sequencing primer GTCAGCTTTTTGTACAAACT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBT346.6-H3.3-K4M-bGHpolyA was a gift from Kai Ge (Addgene plasmid # 128743 ; http://n2t.net/addgene:128743 ; RRID:Addgene_128743) -
For your References section:
H3.3K4M destabilizes enhancer H3K4 methyltransferases MLL3/MLL4 and impairs adipose tissue development. Jang Y, Broun A, Wang C, Park YK, Zhuang L, Lee JE, Froimchuk E, Liu C, Ge K. Nucleic Acids Res. 2019 Jan 25;47(2):607-620. doi: 10.1093/nar/gky982. 10.1093/nar/gky982 PubMed 30335158