Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #128743)


Item Catalog # Description Quantity Price (USD)
Plasmid 128743 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Applied StemCell
  • Backbone size w/o insert (bp) 818
  • Total vector size (bp) 7065
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
  • GenBank ID
  • Entrez Gene
    H3-3A (a.k.a. H3-3B, H3.3A, H3F3, H3F3A)
  • Promoter CAG
  • Tags / Fusion Proteins
    • FLAG (C terminal on insert)
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer CTTATATAACTTCGTATAATG
  • 3′ sequencing primer GTCAGCTTTTTGTACAAACT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBT346.6-H3.3-K4M-bGHpolyA was a gift from Kai Ge (Addgene plasmid # 128743 ; ; RRID:Addgene_128743)
  • For your References section:

    H3.3K4M destabilizes enhancer H3K4 methyltransferases MLL3/MLL4 and impairs adipose tissue development. Jang Y, Broun A, Wang C, Park YK, Zhuang L, Lee JE, Froimchuk E, Liu C, Ge K. Nucleic Acids Res. 2019 Jan 25;47(2):607-620. doi: 10.1093/nar/gky982. 10.1093/nar/gky982 PubMed 30335158