Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGK-Ptrf-mKate2
(Plasmid #128765)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128765 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGK:HygroR-CMV:mKate2-B_UTR Addgene #68480
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 8164
  • Total vector size (bp) 8913
  • Modifications to backbone
    Ptrf regulatory sequence (chr11:100,830,367-100,831,115) was inserted into pGK:HygroR-CMV:mKate2-B_UTR (a gift from Tyler Jacks; Addgene #68480), in place of CMV, after excision with AfeI and AvrII (NEB).
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ptrf promoter
  • Alt name
    Cavin1; Cavin; Cav-p60; AW546441; 2310075E07Rik
  • Alt name
    ENSMUSG00000004044
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    749
  • Entrez Gene
    Cavin1 (a.k.a. 2310075E07Rik, Cav-p60, Cavin, Ptrf)
  • Promoter Ptrf

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCGTGAACAACCACCACTT
  • 3′ sequencing primer CCACTATCGGCGAGTACTTCTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/642900v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGK-Ptrf-mKate2 was a gift from Deepak Srivastava (Addgene plasmid # 128765 ; http://n2t.net/addgene:128765 ; RRID:Addgene_128765)
  • For your References section:

    Context-Specific Transcription Factor Functions Regulate Epigenomic and Transcriptional Dynamics during Cardiac Reprogramming. Stone NR, Gifford CA, Thomas R, Pratt KJB, Samse-Knapp K, Mohamed TMA, Radzinsky EM, Schricker A, Ye L, Yu P, van Bemmel JG, Ivey KN, Pollard KS, Srivastava D. Cell Stem Cell. 2019 Jul 3;25(1):87-102.e9. doi: 10.1016/j.stem.2019.06.012. 10.1016/j.stem.2019.06.012 PubMed 31271750