pGK-Ptrf-mKate2
(Plasmid
#128765)
-
PurposeFluorescent mKate reporter for Ptrf
-
Depositing Lab
-
Depositing OrganizationJ. David Gladstone Institutes
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128765 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGK:HygroR-CMV:mKate2-B_UTR Addgene #68480
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 8164
- Total vector size (bp) 8913
-
Modifications to backbonePtrf regulatory sequence (chr11:100,830,367-100,831,115) was inserted into pGK:HygroR-CMV:mKate2-B_UTR (a gift from Tyler Jacks; Addgene #68480), in place of CMV, after excision with AfeI and AvrII (NEB).
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePtrf promoter
-
Alt nameCavin1; Cavin; Cav-p60; AW546441; 2310075E07Rik
-
Alt nameENSMUSG00000004044
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)749
-
Entrez GeneCavin1 (a.k.a. 2310075E07Rik, Cav-p60, Cavin, Ptrf)
- Promoter Ptrf
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGTGAACAACCACCACTT
- 3′ sequencing primer CCACTATCGGCGAGTACTTCTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/642900v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGK-Ptrf-mKate2 was a gift from Deepak Srivastava (Addgene plasmid # 128765 ; http://n2t.net/addgene:128765 ; RRID:Addgene_128765) -
For your References section:
Context-Specific Transcription Factor Functions Regulate Epigenomic and Transcriptional Dynamics during Cardiac Reprogramming. Stone NR, Gifford CA, Thomas R, Pratt KJB, Samse-Knapp K, Mohamed TMA, Radzinsky EM, Schricker A, Ye L, Yu P, van Bemmel JG, Ivey KN, Pollard KS, Srivastava D. Cell Stem Cell. 2019 Jul 3;25(1):87-102.e9. doi: 10.1016/j.stem.2019.06.012. 10.1016/j.stem.2019.06.012 PubMed 31271750