pLenti-5HRE-GFP NeoR
(Plasmid #128960)

• Purpose: Lentiviral plasmid for expression of hypoxia-responsive enhanced green fluorescent protein
• Depositing Lab: Carlos Carmona-Fontaine
• Publication: Janska et al Dis Model Mech. 2021 Aug 1;14(8). pii: 271783. doi: 10.1242/dmm.048942. Epub 2021 Aug 18.

Backbone

• Vector backbone: LV 1-5
• Total vector size (bp): 9282
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 5X HRE of VEGF
• Alt name: VEGF
• Alt name: VEGFA
• Species: H. sapiens (human)
• Insert Size (bp): 1569
• Entrez Gene: VEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
• Promoter: minimal CMV promoter
• Tag / Fusion Protein:
  • d2EGFP (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGGTTTATTACAGGGACAGC
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pLenti-5HRE-GFP NeoR.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry