Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

TfR-sfGFP-myc tag-SpyCatcher003
(Plasmid #133451)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 133451 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pENTR4
  • Backbone size w/o insert (bp) 4766
  • Total vector size (bp) 6172
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TfR-sfGFP-myc tag-SpyCatcher003
  • Species
    Synthetic
  • Insert Size (bp)
    1410
  • Mutation
    Contains C20 and A23 mutations that improve plasma membrane display of the transferrin receptor (TfR)
  • Promoter CMV
  • Tags / Fusion Proteins
    • GSSGS (C terminal on insert)
    • myc tag

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer BGHFor (GACAGACTAACAGACTGTTCCTTTCC)
  • 3′ sequencing primer BGH reverse
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TfR-sfGFP-myc tag-SpyCatcher003 was a gift from Mark Howarth (Addgene plasmid # 133451 ; http://n2t.net/addgene:133451 ; RRID:Addgene_133451)
  • For your References section:

    Approaching infinite affinity through engineering of peptide-protein interaction. Keeble AH, Turkki P, Stokes S, Khairil Anuar INA, Rahikainen R, Hytonen VP, Howarth M. Proc Natl Acad Sci U S A. 2019 Dec 10. pii: 1909653116. doi: 10.1073/pnas.1909653116. 10.1073/pnas.1909653116 PubMed 31822621