Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-1
(Plasmid #129029)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 129029 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PX458
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 48138)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9-huTET1CD, SgRNA1 (huTSDR)
  • Alt name
    dCas9-huTET1CD-T2A-mCherry
  • gRNA/shRNA sequence
    GTCTGTGGTTTTGAGATTCT
  • Species
    Synthetic
  • Mutation
    dCas9 (D10A;H840A)
  • Promoter CbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)
  • Tags / Fusion Proteins
    • HA-Tag, NLS (N terminal on insert)
    • T2A-mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer SgRNA-cloning-site: hU6-F (GAGGGCCTATTTCCCATGATT)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mCherry (BbsI removed) from Nicola Patron (Addgene plasmid # 50316); HA tag-NLS-dCas9 from Rudolf Jaenisch (Addgene plasmid # 48223); huTET1CD from Keith Joung (Addgene plasmid # 49236)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-1 was a gift from Julia K Polansky (Addgene plasmid # 129029 ; http://n2t.net/addgene:129029 ; RRID:Addgene_129029)
  • For your References section:

    Targeted De-Methylation of the FOXP3-TSDR Is Sufficient to Induce Physiological FOXP3 Expression but Not a Functional Treg Phenotype. Kressler C, Gasparoni G, Nordstrom K, Hamo D, Salhab A, Dimitropoulos C, Tierling S, Reinke P, Volk HD, Walter J, Hamann A, Polansky JK. Front Immunol. 2021 Jan 7;11:609891. doi: 10.3389/fimmu.2020.609891. eCollection 2020. 10.3389/fimmu.2020.609891 PubMed 33488615