pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-12
(Plasmid
#129040)
-
Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA12 targeting human TSDR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129040 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX458
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 48138)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-huTET1CD, SgRNA12 (huTSDR)
-
Alt namedCas9-huTET1CD-T2A-mCherry
-
gRNA/shRNA sequenceTCTGAGAAACCCAGTCAGAA
-
SpeciesSynthetic
-
MutationdCas9 (D10A;H840A)
- Promoter CbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)
-
Tags
/ Fusion Proteins
- HA-Tag, NLS (N terminal on insert)
- T2A-mCherry (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer SgRNA-cloning-site: hU6-F (GAGGGCCTATTTCCCATGATT)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymCherry (BbsI removed) from Nicola Patron (Addgene plasmid # 50316); HA tag-NLS-dCas9 from Rudolf Jaenisch (Addgene plasmid # 48223); huTET1CD from Keith Joung (Addgene plasmid # 49236)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-12 was a gift from Julia K Polansky (Addgene plasmid # 129040 ; http://n2t.net/addgene:129040 ; RRID:Addgene_129040) -
For your References section:
Targeted De-Methylation of the FOXP3-TSDR Is Sufficient to Induce Physiological FOXP3 Expression but Not a Functional Treg Phenotype. Kressler C, Gasparoni G, Nordstrom K, Hamo D, Salhab A, Dimitropoulos C, Tierling S, Reinke P, Volk HD, Walter J, Hamann A, Polansky JK. Front Immunol. 2021 Jan 7;11:609891. doi: 10.3389/fimmu.2020.609891. eCollection 2020. 10.3389/fimmu.2020.609891 PubMed 33488615