Skip to main content

pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-5
(Plasmid #129045)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129045 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX458
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 48138)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9-hudTET1CD, SgRNA5 (huTSDR)
  • Alt name
    dCas9-hudTET1CD-T2A-mCherry
  • gRNA/shRNA sequence
    TGGGTGCTGGTGGATGTGGT
  • Species
    Synthetic
  • Mutation
    dCas9 (D10A;H840A), catalytic domain huTET1 inactive (H1671Y; D1673A)
  • Promoter CbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)
  • Tags / Fusion Proteins
    • HA-Tag, NLS (N terminal on insert)
    • T2A-mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer SgRNA-cloning-site: hU6-F (GAGGGCCTATTTCCCATGATT)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mCherry (BbsI removed) from Nicola Patron (Addgene plasmid # 50316); HA tag-NLS-dCas9 from Rudolf Jaenisch (Addgene plasmid # 48223); hudTET1CD from Keith Joung (Addgene plasmid # 49965).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-5 was a gift from Julia K Polansky (Addgene plasmid # 129045 ; http://n2t.net/addgene:129045 ; RRID:Addgene_129045)
  • For your References section:

    Targeted De-Methylation of the FOXP3-TSDR Is Sufficient to Induce Physiological FOXP3 Expression but Not a Functional Treg Phenotype. Kressler C, Gasparoni G, Nordstrom K, Hamo D, Salhab A, Dimitropoulos C, Tierling S, Reinke P, Volk HD, Walter J, Hamann A, Polansky JK. Front Immunol. 2021 Jan 7;11:609891. doi: 10.3389/fimmu.2020.609891. eCollection 2020. 10.3389/fimmu.2020.609891 PubMed 33488615