co luxE pcDNA3.1(+)
(Plasmid
#129089)
-
PurposeExpression of luxE in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(+)
- Backbone size w/o insert (bp) 5378
- Total vector size (bp) 6491
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameco luxE
-
Alt namecodon-optimized luxE
-
SpeciesSynthetic
-
Insert Size (bp)1113
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TGACGCAAATGGGCGGTA
- 3′ sequencing primer GAAAGGACAGTGGGAGTGGCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
co luxE pcDNA3.1(+) was a gift from Stefan Hell (Addgene plasmid # 129089 ; http://n2t.net/addgene:129089 ; RRID:Addgene_129089) -
For your References section:
Autonomous bioluminescence imaging of single mammalian cells with the bacterial bioluminescence system. Gregor C, Pape JK, Gwosch KC, Gilat T, Sahl SJ, Hell SW. Proc Natl Acad Sci U S A. 2019 Dec 2. pii: 1913616116. doi: 10.1073/pnas.1913616116. 10.1073/pnas.1913616116 PubMed 31792180