Skip to main content
Addgene
Open Menu

pBS42-pre-pro-subtiligase-V177A-His6
(Plasmid #129137)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129137 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBS42
  • Backbone size w/o insert (bp) 5337
  • Total vector size (bp) 6590
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    This is an E. coli / B. subtilis shuttle vector. It has an ampicillin resistance cassette that functions in E. coli and a chloramphenicol resistance cassette that functions in B. subtilis.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    pre-pro-subtiligase-V177A-His6
  • Alt name
    Subtiligase-V177A
  • Species
    Synthetic
  • Insert Size (bp)
    1253
  • Promoter subtilisin promoter from Bacillus amyloliquefaciens
  • Tag / Fusion Protein
    • His6 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGTTTTTCTTGGAATTGTGCTG
  • 3′ sequencing primer GGGAGCCATCCGTCGATTATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This is a synthetic, codon optimized gene that was purchased from Integrated DNA Technologies.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBS42-pre-pro-subtiligase-V177A-His6 was a gift from Jim Wells (Addgene plasmid # 129137)

  • For your References section:

    Engineering peptide ligase specificity by proteomic identification of ligation sites. Weeks AM, Wells JA. Nat Chem Biol. 2018 Jan;14(1):50-57. doi: 10.1038/nchembio.2521. Epub 2017 Nov 20. 10.1038/nchembio.2521 PubMed 29155430
Related items: