Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLL1273
(Plasmid #129288)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 129288 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLL1270
  • Backbone size w/o insert (bp) 7210
  • Total vector size (bp) 11549
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    alpha-Xylp_1211 (Ga0256695_ 1211)
  • Species
    LL1355
  • Insert Size (bp)
    1980
  • GenBank ID
    NZ_RSDX01000001
  • Promoter Clostridium thermocellum DSM1313 Cellobiose phosphorylase (CBP) Clo1313_1954

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTATAGAGCTTAGGGAGAGG
  • 3′ sequencing primer CTGTCAAATATCGCCTTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    alpha-L-Galp_687 (Ga0256695_ 0687)
  • Species
    LL1355
  • Insert Size (bp)
    2004
  • GenBank ID
    NZ_RSDX01000001
  • Promoter Clostridium thermocellum DSM1313 Cellobiose phosphorylase (CBP) Clo1313_1954

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCAAGTCAACCTATCCAA
  • 3′ sequencing primer CTGATTATTGCCCTCGTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL1273 was a gift from Lee Lynd (Addgene plasmid # 129288 ; http://n2t.net/addgene:129288 ; RRID:Addgene_129288)