pLL1274
(Plasmid
#129385)
-
PurposeExpression plasmid with pLL1270 as backbone and alpha-Xylp_1211 and alpha-L-Araf_996 as inserts
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129385 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLL1270
- Backbone size w/o insert (bp) 7210
- Total vector size (bp) 10631
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namealpha-Xylp_1211 (Ga0256695_ 1211)
-
SpeciesLL1355
-
Insert Size (bp)1980
-
GenBank IDNZ_RSDX01000001
- Promoter Clostridium thermocellum DSM1313 Cellobiose phosphorylase (CBP) Clo1313_1954
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TTATAGAGCTTAGGGAGAGG
- 3′ sequencing primer CTGTCAAATATCGCCTTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namealpha-L-AraF_996 (Ga0256695_ 0996)
-
SpeciesLL1355
-
Insert Size (bp)1418
-
GenBank IDNZ_RSDX01000001
- Promoter Clostridium thermocellum DSM1313 Cellobiose phosphorylase (CBP) Clo1313_1954
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGGTAAAGGCGAATATG
- 3′ sequencing primer TACTATTGAACGCCTGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLL1274 was a gift from Lee Lynd (Addgene plasmid # 129385 ; http://n2t.net/addgene:129385 ; RRID:Addgene_129385)