pGL3-Basic-ACSL3-sfGFP(C) HDR template
(Plasmid
#129413)
-
PurposeHDR tempalte for tagging of endogenous human ACSL3 C-terminus with sfGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129413 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL3-basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 4482
-
Modifications to backboneOnly plasmid backbone for amplification in E.coli was used.
-
Vector typeMammalian Expression, CRISPR, TALEN ; Endogenous tagging HDR template
-
Selectable markersNo selection marker on this plasmid
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameACSL3 HDR template
-
Alt nameACS3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1667
-
GenBank ID2181
-
Entrez GeneACSL3 (a.k.a. ACS3, FACL3, LACS 3, LACS3, PRO2194)
-
Tag
/ Fusion Protein
- sfGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer agtgcaggtgccagaacatt
- 3′ sequencing primer ggaaggagctgactgggttg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector was designed and generated by Shiqian Li (Elina Ikonen Lab).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Basic-ACSL3-sfGFP(C) HDR template was a gift from Elina Ikonen (Addgene plasmid # 129413 ; http://n2t.net/addgene:129413 ; RRID:Addgene_129413) -
For your References section:
Seipin Facilitates Triglyceride Flow to Lipid Droplet and Counteracts Droplet Ripening via Endoplasmic Reticulum Contact. Salo VT, Li S, Vihinen H, Holtta-Vuori M, Szkalisity A, Horvath P, Belevich I, Peranen J, Thiele C, Somerharju P, Zhao H, Santinho A, Thiam AR, Jokitalo E, Ikonen E. Dev Cell. 2019 Jun 6. pii: S1534-5807(19)30388-0. doi: 10.1016/j.devcel.2019.05.016. 10.1016/j.devcel.2019.05.016 PubMed 31178403