pFB1_hPMS2
(Plasmid
#129425)
-
PurposeExpression human PMS2 protein using baculovirus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129425 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastBac 1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4776
- Total vector size (bp) 7333
-
Modifications to backbonehPMS2 is inserted in MCS (5'- BamH 1 and 3'- Sal I) of pFastBac 1. 5' sequencing primer covers nucleotides from 112-142 of hPMS2, but antiparallel, 3' sequencing primer covers nucleotides from 2456-2490 of hPMS2. They are used to sequence junction of the insert. The plasmid is used to amplify and generate recombinant bacmid DNA. which will then be transfected into insect cells for virus generation and eventually for protein (hPMS2) expression.
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse DH10Bac for bacmid expression.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman PMS2
-
Alt nameDNA mismatch repair protein homolog (PMS2)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2589
-
GenBank IDU14658
-
Entrez GenePMS2 (a.k.a. HNPCC4, LYNCH4, MLH4, MMRCS4, PMS-2, PMS2CL, PMSL2)
- Promoter Polyhedrin promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Sal I (not destroyed)
- 5′ sequencing primer ccagactgttttctactaactcctttaccgc
- 3′ sequencing primer ggactgctctcaacacaagcgagatgaagaaactg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB1_hPMS2 was a gift from Peggy Hsieh (Addgene plasmid # 129425 ; http://n2t.net/addgene:129425 ; RRID:Addgene_129425) -
For your References section:
In vitro studies of DNA mismatch repair proteins. Geng H, Du C, Chen S, Salerno V, Manfredi C, Hsieh P. Anal Biochem. 2011 Jun 15;413(2):179-84. doi: 10.1016/j.ab.2011.02.017. Epub 2011 Feb 15. 10.1016/j.ab.2011.02.017 PubMed 21329650