Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pB-RTP1S-Integration
(Plasmid #129458)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 129458 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pB-CMV expression vector
  • Backbone manufacturer
    SBI
  • Backbone size w/o insert (bp) 6969
  • Total vector size (bp) 7653
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RTP1
  • Alt name
    RTP1S receptor transporting protein 1 short
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    684
  • Mutation
    Removal of the first 36 amino acids of the protein
  • GenBank ID
    239766
  • Entrez Gene
    Rtp1 (a.k.a. Gm1766, Gm604)
  • Promoter TRE (Tet-On)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAGACACCGGGACCGATCCA
  • 3′ sequencing primer gcagacactctatgcctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pB-RTP1S-Integration was a gift from Sriram Kosuri (Addgene plasmid # 129458 ; http://n2t.net/addgene:129458 ; RRID:Addgene_129458)
  • For your References section:

    A Scalable, Multiplexed Assay for Decoding GPCR-Ligand Interactions with RNA Sequencing. Jones EM, Jajoo R, Cancilla D, Lubock NB, Wang J, Satyadi M, Cheung R, de March C, Bloom JS, Matsunami H, Kosuri S. Cell Syst. 2019 Mar 27;8(3):254-260.e6. doi: 10.1016/j.cels.2019.02.009. Epub 2019 Mar 20. 10.1016/j.cels.2019.02.009 PubMed 30904378