Skip to main content

pET23b-15F11-HA-mEGFP-6xHis
(Plasmid #129593)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129593 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET23b
  • Backbone manufacturer
    Millipore Sigma
  • Backbone size w/o insert (bp) 3666
  • Total vector size (bp) 5162
  • Modifications to backbone
    No modifications to backbone
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Anti-HA frankenbody-mEGFP (15F11-HA scFv-mEGFP)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1574
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET23b-15F11-HA-mEGFP-6xHis was a gift from Tim Stasevich (Addgene plasmid # 129593 ; http://n2t.net/addgene:129593 ; RRID:Addgene_129593)
  • For your References section:

    A genetically encoded probe for imaging nascent and mature HA-tagged proteins in vivo. Zhao N, Kamijo K, Fox PD, Oda H, Morisaki T, Sato Y, Kimura H, Stasevich TJ. Nat Commun. 2019 Jul 3;10(1):2947. doi: 10.1038/s41467-019-10846-1. 10.1038/s41467-019-10846-1 PubMed 31270320