Skip to main content

pET20b-YbAnbu
(Plasmid #129637)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129637 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET20b
  • Backbone manufacturer
    Novagene
  • Backbone size w/o insert (bp) 3716
  • Total vector size (bp) 4322
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For expression in BL21(DE3) no IPTG induction required
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YbAnbu
  • Species
    Yersinia bercovieri
  • Insert Size (bp)
    735
  • Mutation
    V14A and G107H
  • GenBank ID
    CNF23894.1 CNI95872.1
  • Promoter T7
  • Tag / Fusion Protein
    • His6-tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET20b-YbAnbu was a gift from Matthias Bochtler (Addgene plasmid # 129637 ; http://n2t.net/addgene:129637 ; RRID:Addgene_129637)
  • For your References section:

    The Y. bercovieri Anbu crystal structure sheds light on the evolution of highly (pseudo)symmetric multimers. Piasecka A, Czapinska H, Vielberg MT, Szczepanowski RH, Kiefersauer R, Reed S, Groll M, Bochtler M. J Mol Biol. 2018 Mar 2;430(5):611-627. doi: 10.1016/j.jmb.2017.11.016. Epub 2017 Dec 16. 10.1016/j.jmb.2017.11.016 PubMed 29258816