NmMetQ WT
(Plasmid
#129647)
-
PurposeExpresses the mature metQ gene from Neisseria meningitides, without the signal sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129647 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET21b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5474
- Total vector size (bp) 6222
-
Modifications to backboneRemoved the 6x His Tag + Stop Codon (caccaccaccaccaccactga) at C Terminal end of the insert
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemetQ Gene
-
Alt nameMethionine Substrate Binding Protein
-
SpeciesNeisseria meningitidis
-
Insert Size (bp)741
-
GenBank IDCP020421.2
- Promoter T7 Promoter
-
Tags
/ Fusion Proteins
- 10x Histidine Tag (N terminal on insert)
- Enterokinase (N terminal on insert)
- pelB signal sequence (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 Forward
- 3′ sequencing primer T7 Reverse
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NmMetQ WT was a gift from Douglas Rees (Addgene plasmid # 129647 ; http://n2t.net/addgene:129647 ; RRID:Addgene_129647) -
For your References section:
Structures of the Neisseria meningitides methionine-binding protein MetQ in substrate-free form and bound to l- and d-methionine isomers. Nguyen PT, Lai JY, Kaiser JT, Rees DC. Protein Sci. 2019 Jul 26. doi: 10.1002/pro.3694. 10.1002/pro.3694 PubMed 31348565