Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #129716)


Item Catalog # Description Quantity Price (USD)
Plasmid 129716 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 8200
  • Total vector size (bp) 10671
  • Vector type
    Mammalian Expression, CRISPR, TALEN ; Human safe harbor locus (A AVS1) site-specific integration
  • Selectable markers
    Puromycin ; mCherry for FACS enrichment

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    auxin signaling F-box 2
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
  • Mutation
    codon optimized
  • Entrez Gene
    AFB2 (a.k.a. AT3G26810, auxin signaling F-box 2)
  • Promoter EF1a
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer tctctccacaggtgtccact
  • 3′ sequencing primer acaccggccttattccaagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH-EFIRES-P-AtAFB2-mCherry was a gift from Elina Ikonen (Addgene plasmid # 129716 ; ; RRID:Addgene_129716)
  • For your References section:

    An efficient auxin-inducible degron system with low basal degradation in human cells. Li S, Prasanna X, Salo VT, Vattulainen I, Ikonen E. Nat Methods. 2019 Aug 26. pii: 10.1038/s41592-019-0512-x. doi: 10.1038/s41592-019-0512-x. 10.1038/s41592-019-0512-x PubMed 31451765