pSH-EFIRES-P-Seipin-miniIAA7-mCherry
(Plasmid
#129720)
-
PurposeAAVS1 safe harbor targeting vector expressing miniIAA7-mCherry tagged Seipin
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSH-EFIRES-P
- Backbone size w/o insert (bp) 8200
- Total vector size (bp) 10379
-
Vector typeMammalian Expression, CRISPR, TALEN ; Human safe harbor locus (A AVS1) site-specific integration
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSeipin
-
Alt nameBSCL2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2160
-
Mutationsilent mutations
-
Entrez GeneBSCL2 (a.k.a. GNG3LG, HMN5, HMN5C, PELD, SPG17)
- Promoter EF1a
-
Tag
/ Fusion Protein
- miniIAA7-mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer tctctccacaggtgtccact
- 3′ sequencing primer acaccggccttattccaagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSH-EFIRES-P-Seipin-miniIAA7-mCherry was a gift from Elina Ikonen (Addgene plasmid # 129720 ; http://n2t.net/addgene:129720 ; RRID:Addgene_129720) -
For your References section:
An efficient auxin-inducible degron system with low basal degradation in human cells. Li S, Prasanna X, Salo VT, Vattulainen I, Ikonen E. Nat Methods. 2019 Aug 26. pii: 10.1038/s41592-019-0512-x. doi: 10.1038/s41592-019-0512-x. 10.1038/s41592-019-0512-x PubMed 31451765